Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGACAGCTCCAGCTCCTTACTCAGC[A/G]GTCAGCTCCAGCACACACTCCATGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 179610 MIM: 602002 | ||||||||||||||||||||
Literature Links: |
EPHA1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EPHA1 - EPH receptor A1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005232.4 | 2934 | Silent Mutation | ACC,ACT | T,T 949 | NP_005223.4 | |
XM_006715880.3 | 2934 | Silent Mutation | ACC,ACT | T,T 834 | XP_006715943.1 |
FAM131B - family with sequence similarity 131 member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6892 - microRNA 6892 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZYX - zyxin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001010972.1 | 2934 | Intron | NP_001010972.1 | |||
NM_003461.4 | 2934 | Intron | NP_003452.1 | |||
XM_011516569.2 | 2934 | Intron | XP_011514871.2 | |||
XM_017012587.1 | 2934 | Intron | XP_016868076.1 |