Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCTGTGCAACATCAACCCACTGC[A/G]CCGCTCGCGCCTAACGCCCAACGAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605464 MIM: 611741 MIM: 123831 MIM: 109280 | ||||||||||||||||||||
Literature Links: |
ABCB8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ABCB8 - ATP binding cassette subfamily B member 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ASIC3 - acid sensing ion channel subunit 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004769.3 | 887 | Missense Mutation | CAC,CGC | H,R 98 | NP_004760.1 | |
NM_020321.3 | 887 | Missense Mutation | CAC,CGC | H,R 98 | NP_064717.1 | |
NM_020322.3 | 887 | Missense Mutation | CAC,CGC | H,R 98 | NP_064718.1 |
CDK5 - cyclin dependent kinase 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC4A2 - solute carrier family 4 member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |