Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTCATCCTGCCCCAGAAGGACTTT[C/T]GTGGTGAGCACAGGCTTGCTGACGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
PSMG3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PSMG3 - proteasome assembly chaperone 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001134340.1 | 846 | Intron | NP_001127812.1 | |||
NM_032302.3 | 846 | Silent Mutation | ACA,ACG | T,T 64 | NP_115678.1 |
PSMG3-AS1 - PSMG3 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM184A - transmembrane protein 184A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |