Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCACCTCGTACCTGCGGTCCCTG[C/G]TGAGGTACATGTTGAACAGAAACTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 142957 MIM: 142950 MIM: 142956 MIM: 609688 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
HOXA-AS3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
HOXA-AS3 - HOXA cluster antisense RNA 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXA10 - homeobox A10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXA10-AS - HOXA10 antisense RNA | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXA10-HOXA9 - HOXA10-HOXA9 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXA7 - homeobox A7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXA9 - homeobox A9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152739.3 | 768 | Missense Mutation | ACC,AGC | T,S 232 | NP_689952.1 |
MIR196B - microRNA 196b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |