Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCATCTGGATATGTGCCCCCACCAG[G/T]GGCCACTCCATTCAGTTCCAAGTCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 179610 MIM: 602002 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
EPHA1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
EPHA1 - EPH receptor A1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM131B - family with sequence similarity 131 member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001031690.2 | 583 | Intron | NP_001026860.2 | |||
NM_001278297.1 | 583 | Intron | NP_001265226.1 | |||
NM_014690.4 | 583 | Intron | NP_055505.3 | |||
XM_005250073.3 | 583 | Intron | XP_005250130.1 | |||
XM_006716186.2 | 583 | Intron | XP_006716249.1 |
LOC100507507 - uncharacterized LOC100507507 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6892 - microRNA 6892 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZYX - zyxin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001010972.1 | 583 | Missense Mutation | GGG,GTG | G,V 177 | NP_001010972.1 | |
NM_003461.4 | 583 | Missense Mutation | GGG,GTG | G,V 177 | NP_003452.1 | |
XM_011516569.2 | 583 | Missense Mutation | GGG,GTG | G,V 146 | XP_011514871.2 | |
XM_017012587.1 | 583 | Missense Mutation | GGG,GTG | G,V 236 | XP_016868076.1 |