Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCCCCGGGTAGAGGCCCATCCTC[C/T]GCACCACCTCCCGGCTGAAGCTGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613302 MIM: 615167 MIM: 610929 | ||||||||||||||||||||
Literature Links: |
ALKBH4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALKBH4 - alkB homolog 4, lysine demethylase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017621.3 | 448 | Missense Mutation | CAG,CGG | Q,R 137 | NP_060091.1 | |
XM_005250464.2 | 448 | Missense Mutation | CAG,CGG | Q,R 64 | XP_005250521.1 | |
XM_005250465.2 | 448 | UTR 5 | XP_005250522.1 |
LRWD1 - leucine rich repeats and WD repeat domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR5090 - microRNA 5090 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ORAI2 - ORAI calcium release-activated calcium modulator 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |