Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTCTGAGCTGGTCAGCACAGCCTG[C/T]GGTTTCCGGCTGCACCGCGGCATGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608235 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C7orf43 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C7orf43 - chromosome 7 open reading frame 43 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001303470.1 | 227 | Intron | NP_001290399.1 | |||
NM_018275.4 | 227 | Intron | NP_060745.3 |
GAL3ST4 - galactose-3-O-sulfotransferase 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LAMTOR4 - late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001008395.3 | 227 | Silent Mutation | TGC,TGT | C,C 51 | NP_001008396.1 | |
NM_001318236.1 | 227 | Silent Mutation | TGC,TGT | C,C 51 | NP_001305165.1 | |
NM_001318237.1 | 227 | Silent Mutation | TGC,TGT | C,C 24 | NP_001305166.1 | |
XM_017012198.1 | 227 | Silent Mutation | TGC,TGT | C,C 51 | XP_016867687.1 | |
XM_017012199.1 | 227 | Silent Mutation | TGC,TGT | C,C 51 | XP_016867688.1 |
MIR4658 - microRNA 4658 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |