Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAACACAGCCATCAACTGCAGGGAT[A/G]AAGTGGTGTCTCCCCTTCCATCTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611478 | ||||||||||||||||||||
Literature Links: |
MEPCE PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MEPCE - methylphosphate capping enzyme | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001194990.1 | 634 | UTR 5 | NP_001181919.1 | |||
NM_001194991.1 | 634 | Intron | NP_001181920.1 | |||
NM_001194992.1 | 634 | Intron | NP_001181921.1 | |||
NM_019606.5 | 634 | Missense Mutation | AAA,GAA | K,E 327 | NP_062552.2 | |
XM_011516410.2 | 634 | Intron | XP_011514712.1 |
PPP1R35 - protein phosphatase 1 regulatory subunit 35 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZCWPW1 - zinc finger CW-type and PWWP domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |