Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGATGGCGGGGAGGGGTAAGCTCAT[C/T]GCAGTGATCGGAGACGAGGACACGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607160 MIM: 102565 MIM: 609344 | ||||||||||||||||||||
Literature Links: |
ATP6V1F PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATP6V1F - ATPase H+ transporting V1 subunit F | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198909.1 | Intron | NP_001185838.1 | ||||
NM_004231.3 | Intron | NP_004222.2 |
FLNC - filamin C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KCP - kielin/chordin-like protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100130705 - uncharacterized LOC100130705 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |