Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATTTGTCTCTCGGAGAGGCAAAGA[A/G]CATGTGCTATTTCAATCCTCCTTCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 142954 MIM: 142952 MIM: 142951 | ||||||||||||||||||||
Literature Links: |
HOXA-AS3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HOXA-AS3 - HOXA cluster antisense RNA 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXA3 - homeobox A3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030661.4 | 753 | Intron | NP_109377.1 | |||
NM_153631.2 | 753 | Intron | NP_705895.1 | |||
XM_005249730.2 | 753 | Intron | XP_005249787.1 | |||
XM_005249731.2 | 753 | Intron | XP_005249788.1 | |||
XM_005249732.3 | 753 | Intron | XP_005249789.1 | |||
XM_006715715.2 | 753 | Intron | XP_006715778.1 | |||
XM_011515343.2 | 753 | Intron | XP_011513645.1 |
HOXA5 - homeobox A5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_019102.3 | 753 | Missense Mutation | GCT,GTT | A,V 231 | NP_061975.2 |
HOXA6 - homeobox A6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |