Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGGAGGCTGGCCCCAGGAAAGGA[C/T]GAGCAGGTCCCCATCCGGGTGGTGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609076 MIM: 607882 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FBXL6 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FBXL6 - F-box and leucine rich repeat protein 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101928902 - uncharacterized LOC101928902 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC52A2 - solute carrier family 52 member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001253815.1 | 789 | Silent Mutation | GAC,GAT | D,D 76 | NP_001240744.1 | |
NM_001253816.1 | 789 | Silent Mutation | GAC,GAT | D,D 76 | NP_001240745.1 | |
NM_024531.4 | 789 | Silent Mutation | GAC,GAT | D,D 76 | NP_078807.1 | |
XM_006716658.2 | 789 | Silent Mutation | GAC,GAT | D,D 76 | XP_006716721.1 | |
XM_006716659.2 | 789 | Silent Mutation | GAC,GAT | D,D 76 | XP_006716722.1 | |
XM_006716660.2 | 789 | Silent Mutation | GAC,GAT | D,D 76 | XP_006716723.1 | |
XM_011517300.2 | 789 | UTR 5 | XP_011515602.1 | |||
XM_017013819.1 | 789 | Silent Mutation | GAC,GAT | D,D 76 | XP_016869308.1 | |
XM_017013820.1 | 789 | Silent Mutation | GAC,GAT | D,D 76 | XP_016869309.1 | |
XM_017013821.1 | 789 | Intron | XP_016869310.1 | |||
XM_017013822.1 | 789 | Intron | XP_016869311.1 |
TMEM249 - transmembrane protein 249 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |