Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGCAGCCGAGGGCCGCGCGGCCGC[G/T]GTGTCCCTGGAAGAGGCCCTACTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616635 MIM: 603621 MIM: 615216 | ||||||||||||||||||||
Literature Links: |
CYHR1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CYHR1 - cysteine and histidine rich 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FOXH1 - forkhead box H1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KIFC2 - kinesin family member C2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_145754.3 | 317 | Silent Mutation | GCG,GCT | A,A 78 | NP_665697.1 | |
XM_005272357.3 | 317 | Silent Mutation | GCG,GCT | A,A 78 | XP_005272414.1 | |
XM_011517362.2 | 317 | Silent Mutation | GCG,GCT | A,A 78 | XP_011515664.1 |