Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGACATCCTGGAGCCGGATGCCGC[A/G]GAACCAGGTGCCTGATGTGGTGCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
GSDMD PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GSDMD - gasdermin D | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001166237.1 | 913 | Silent Mutation | GCA,GCG | A,A 70 | NP_001159709.1 | |
NM_024736.6 | 913 | Silent Mutation | GCA,GCG | A,A 70 | NP_079012.3 | |
XM_011517301.1 | 913 | Silent Mutation | GCA,GCG | A,A 70 | XP_011515603.1 |
MROH6 - maestro heat like repeat family member 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZC3H3 - zinc finger CCCH-type containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |