Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTACTTCAAGCACAACAACATGGC[C/G]AGCTTCGTGCGGCAGCTCAACATGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604900 MIM: 140580 | ||||||||||||||||||||
Literature Links: |
DGAT1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DGAT1 - diacylglycerol O-acyltransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HSF1 - heat shock transcription factor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_005272315.2 | 371 | Silent Mutation | GCC,GCG | A,A 67 | XP_005272372.1 | |
XM_005272316.2 | 371 | Silent Mutation | GCC,GCG | A,A 67 | XP_005272373.1 | |
XM_005272317.1 | 371 | Silent Mutation | GCC,GCG | A,A 67 | XP_005272374.1 | |
XM_011517004.2 | 371 | Intron | XP_011515306.1 | |||
XM_011517006.2 | 371 | Intron | XP_011515308.1 | |||
XM_017013377.1 | 371 | Silent Mutation | GCC,GCG | A,A 67 | XP_016868866.1 |
MIR6848 - microRNA 6848 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |