Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCAAGCTGGCACAGCTGATCTCAG[C/G]GTTGGCAGACAGATCCAGTGAGATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604546 MIM: 611952 | ||||||||||||||||||||
Literature Links: |
MIR6893 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR6893 - microRNA 6893 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TONSL - tonsoku-like, DNA repair protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013432.4 | 3874 | Missense Mutation | CCT,GCT | P,A 1287 | NP_038460.4 | |
XM_011517048.2 | 3874 | Missense Mutation | CCT,GCT | P,A 963 | XP_011515350.1 | |
XM_011517049.2 | 3874 | Missense Mutation | CCT,GCT | P,A 951 | XP_011515351.1 | |
XM_011517050.2 | 3874 | Intron | XP_011515352.1 |
TONSL-AS1 - TONSL antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VPS28 - VPS28, ESCRT-I subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |