Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCTTGGTAACCGCAAAGGGGGAGA[A/G]TCACCCGTCTCCTAATTTTAACCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 125305 MIM: 603725 MIM: 608073 | ||||||||||||||||||||
Literature Links: |
DMTN PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DMTN - dematin actin binding protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FGF17 - fibroblast growth factor 17 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304478.1 | 1450 | Intron | NP_001291407.1 | |||
NM_003867.3 | 1450 | Missense Mutation | AAT,AGT | N,S 27 | NP_003858.1 | |
XM_005273675.1 | 1450 | Missense Mutation | AAT,AGT | N,S 50 | XP_005273732.1 | |
XM_011544683.1 | 1450 | Missense Mutation | AAT,AGT | N,S 43 | XP_011542985.1 | |
XM_011544684.2 | 1450 | Missense Mutation | AAT,AGT | N,S 43 | XP_011542986.1 | |
XM_011544685.1 | 1450 | Intron | XP_011542987.1 |
NPM2 - nucleophosmin/nucleoplasmin 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |