Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAGTATCTGACCAACACTCATCCT[C/T]GGTGTCGCTGTCCTGCAGGCCCCCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602302 MIM: 608302 MIM: 609349 | ||||||||||||||||||||
Literature Links: |
HR PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HR - hair growth associated | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LGI3 - leucine rich repeat LGI family member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
REEP4 - receptor accessory protein 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001316964.1 | 1058 | Intron | NP_001303893.1 | |||
NM_001316965.1 | 1058 | Silent Mutation | CCA,CCG | P,P 151 | NP_001303894.1 | |
NM_025232.3 | 1058 | Missense Mutation | AAG,GAG | K,E 197 | NP_079508.2 |