Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGACGGCTCCTTCAGCCAGGGCCT[C/T]GGAGAATGCACACACCTGTAGCCGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 130592 MIM: 616408 MIM: 137020 | ||||||||||||||||||||
Literature Links: |
EEF1D PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EEF1D - eukaryotic translation elongation factor 1 delta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PYCRL - pyrroline-5-carboxylate reductase-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TIGD5 - tigger transposable element derived 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSTA3 - tissue specific transplantation antigen P35B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |