Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCTGGGCACTGACTGCCCTTCTG[A/G]TCGCTTCAGCTGCTGCCTTCCAGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609076 MIM: 607882 | ||||||||||||||||||||
Literature Links: |
FBXL6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FBXL6 - F-box and leucine rich repeat protein 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101928902 - uncharacterized LOC101928902 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC52A2 - solute carrier family 52 member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM249 - transmembrane protein 249 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |