Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCATGAGGCCTGACATAATGAACA[A/G]GGGGTGATGATGGCCTGGCTGAGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611552 | ||||||||||||||||||||
Literature Links: |
GSDMD PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GSDMD - gasdermin D | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MROH6 - maestro heat like repeat family member 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001100878.1 | 2750 | UTR 3 | NP_001094348.1 | |||
XM_006716615.2 | 2750 | Intron | XP_006716678.1 | |||
XM_011517214.1 | 2750 | Intron | XP_011515516.1 | |||
XM_011517215.1 | 2750 | Intron | XP_011515517.1 | |||
XM_011517216.2 | 2750 | Intron | XP_011515518.1 | |||
XM_011517217.1 | 2750 | Intron | XP_011515519.1 | |||
XM_011517218.1 | 2750 | UTR 3 | XP_011515520.1 | |||
XM_011517219.1 | 2750 | Intron | XP_011515521.1 | |||
XM_011517220.1 | 2750 | Intron | XP_011515522.1 | |||
XM_011517221.2 | 2750 | Intron | XP_011515523.1 | |||
XM_011517222.1 | 2750 | Intron | XP_011515524.1 | |||
XM_011517223.1 | 2750 | Intron | XP_011515525.1 |
NAPRT - nicotinate phosphoribosyltransferase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |