Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCAGACTTGGACTCAGATCCCTT[C/T]GGGGAGGATGGTAGCCTCTGGTCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 123980 MIM: 610210 MIM: 611885 | ||||||||||||||||||||
Literature Links: |
CYC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CYC1 - cytochrome c1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAF1 - MAF1 homolog, negative regulator of RNA polymerase III | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032272.4 | 1155 | Silent Mutation | TTC,TTT | F,F 177 | NP_115648.2 | |
XM_017013903.1 | 1155 | Silent Mutation | TTC,TTT | F,F 177 | XP_016869392.1 | |
XM_017013904.1 | 1155 | Intron | XP_016869393.1 |
SHARPIN - SHANK associated RH domain interactor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR97 - WD repeat domain 97 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |