Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTAGAGTCATGGCCTCGAGCACAG[A/G]TGACCGGAGCCAGGCGGTGAGGCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 138200 MIM: 609172 MIM: 603780 | ||||||||||||||||||||
Literature Links: |
GPT PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GPT - glutamic--pyruvic transaminase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005309.2 | 930 | Missense Mutation | GAT,GGT | D,G 6 | NP_005300.1 | |
XM_011516993.2 | 930 | Missense Mutation | GAT,GGT | D,G 6 | XP_011515295.1 |
LOC101928953 - uncharacterized LOC101928953 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MFSD3 - major facilitator superfamily domain containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP1R16A - protein phosphatase 1 regulatory subunit 16A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RECQL4 - RecQ like helicase 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |