Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTAAACCACAGGTAGGATGTAGCTG[C/T]AGAGAGTCCATACCTAGGGGTTGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 185641 MIM: 185640 MIM: 185620 MIM: 185630 MIM: 185660 | ||||||||||||||||||||
Literature Links: |
MED22 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MED22 - mediator complex subunit 22 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL7A - ribosomal protein L7a | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000972.2 | 827 | Intron | NP_000963.1 |
SNORD24 - small nucleolar RNA, C/D box 24 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD36A - small nucleolar RNA, C/D box 36A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD36B - small nucleolar RNA, C/D box 36B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD36C - small nucleolar RNA, C/D box 36C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SURF1 - surfeit 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001280787.1 | 827 | Missense Mutation | ACA,GCA | T,A 174 | NP_001267716.1 | |
NM_003172.3 | 827 | Missense Mutation | ACA,GCA | T,A 283 | NP_003163.1 | |
XM_011518942.1 | 827 | Missense Mutation | ACA,GCA | T,A 174 | XP_011517244.1 |
SURF2 - surfeit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SURF4 - surfeit 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |