Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTTCCAGAAACAACGGAGATGGTG[C/G]TGAAGAAGGCTCTGGGTTCAAATTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607001 | ||||||||||||||||||||
Literature Links: |
ARRDC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARRDC1 - arrestin domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317968.1 | Intron | NP_001304897.1 | ||||
NM_152285.3 | Intron | NP_689498.1 | ||||
XM_005266119.1 | Intron | XP_005266176.1 | ||||
XM_006717320.3 | Intron | XP_006717383.1 | ||||
XM_006717321.3 | Intron | XP_006717384.1 | ||||
XM_006717322.3 | Intron | XP_006717385.1 | ||||
XM_017015288.1 | Intron | XP_016870777.1 |
ARRDC1-AS1 - ARRDC1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EHMT1 - euchromatic histone lysine methyltransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |