Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCAGTGAGGAAAGCCGCCAGCTCT[C/T]GGGCTGAGCCAAAGTCATCCACATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600047 MIM: 602030 MIM: 605798 | ||||||||||||||||||||
Literature Links: |
ABCA2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ABCA2 - ATP binding cassette subfamily A member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C9orf139 - chromosome 9 open reading frame 139 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_207511.2 | 1691 | Intron | NP_997394.1 | |||
XM_017014717.1 | 1691 | Intron | XP_016870206.1 |
FUT7 - fucosyltransferase 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004479.3 | 1691 | Missense Mutation | CAA,CGA | Q,R 281 | NP_004470.1 |
NPDC1 - neural proliferation, differentiation and control 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |