Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCACCTCCCTCCGCACCTGAGGTC[A/G]AGGTGGTGCGCTCCCCCCTGGATGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610537 MIM: 604346 | ||||||||||||||||||||
Literature Links: |
DPP7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DPP7 - dipeptidyl peptidase 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013379.2 | 1365 | Silent Mutation | CTC,CTT | L,L 445 | NP_037511.2 | |
XM_005266075.3 | 1365 | Silent Mutation | CTC,CTT | L,L 518 | XP_005266132.1 | |
XM_006717083.3 | 1365 | Nonsense Mutation | CGA,TGA | R,* 496 | XP_006717146.1 | |
XM_011518599.2 | 1365 | Silent Mutation | CTC,CTT | L,L 467 | XP_011516901.1 | |
XM_011518600.1 | 1365 | Silent Mutation | CTC,CTT | L,L 437 | XP_011516902.1 | |
XM_017014651.1 | 1365 | Nonsense Mutation | CGA,TGA | R,* 445 | XP_016870140.1 | |
XM_017014652.1 | 1365 | Nonsense Mutation | CGA,TGA | R,* 423 | XP_016870141.1 |
LOC101930307 - uncharacterized LOC101930307 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAN1B1 - mannosidase alpha class 1B member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |