Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGACAGAGGAACAAATTCTGAAAC[A/G]TGTGCGGAGGAAGATTCGAAATAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606443 MIM: 609471 MIM: 186745 | ||||||||||||||||||||
Literature Links: |
CREB3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CREB3 - cAMP responsive element binding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006368.4 | 911 | Missense Mutation | CAT,CGT | H,R 153 | NP_006359.3 |
GBA2 - glucosylceramidase beta 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6853 - microRNA 6853 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TLN1 - talin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |