Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAAAAGCTTGATGGTGGTTTGAGT[A/G]TTCTGTAGTAAGATCATAAAAAAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600712 MIM: 615239 MIM: 610404 | ||||||||||||||||||||
Literature Links: |
HNRNPK PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HNRNPK - heterogeneous nuclear ribonucleoprotein K | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318186.1 | Intron | NP_001305115.1 | ||||
NM_001318187.1 | Intron | NP_001305116.1 | ||||
NM_001318188.1 | Intron | NP_001305117.1 | ||||
NM_002140.4 | Intron | NP_002131.2 | ||||
NM_031262.3 | Intron | NP_112552.1 | ||||
NM_031263.3 | Intron | NP_112553.1 | ||||
XM_005251960.2 | Intron | XP_005252017.1 | ||||
XM_005251963.3 | Intron | XP_005252020.1 | ||||
XM_005251965.2 | Intron | XP_005252022.1 | ||||
XM_011518616.1 | Intron | XP_011516918.1 | ||||
XM_017014668.1 | Intron | XP_016870157.1 | ||||
XM_017014669.1 | Intron | XP_016870158.1 |
MIR7-1 - microRNA 7-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RMI1 - RecQ mediated genome instability 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |