Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCGCATATTTAGTAGCATTGGCCAC[C/T]GAAAATATTCTACATATTTAAATGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
KIAA2026 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KIAA2026 - KIAA2026 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4665 - microRNA 4665 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RANBP6 - RAN binding protein 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243202.1 | Intron | NP_001230131.1 | ||||
NM_001243203.1 | Intron | NP_001230132.1 | ||||
NM_012416.3 | Intron | NP_036548.1 | ||||
XM_017014624.1 | Intron | XP_016870113.1 |