Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTGCTAGGCGTCGTCACTGCAGTG[A/G]TCTGGAGCAGTCAGCAGGGGGCGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604134 MIM: 602930 | ||||||||||||||||||||
Literature Links: |
ADAMTS13 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ADAMTS13 - ADAM metallopeptidase with thrombospondin type 1 motif 13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
REXO4 - REX4 homolog, 3'-5' exonuclease | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001279349.1 | 1183 | Silent Mutation | GAC,GAT | D,D 244 | NP_001266278.1 | |
NM_001279350.1 | 1183 | Silent Mutation | GAC,GAT | D,D 279 | NP_001266279.1 | |
NM_001279351.1 | 1183 | Silent Mutation | GAC,GAT | D,D 323 | NP_001266280.1 | |
NM_020385.3 | 1183 | Silent Mutation | GAC,GAT | D,D 416 | NP_065118.2 |
STKLD1 - serine/threonine kinase like domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_153710.4 | 1183 | Intron | NP_714921.4 |