Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCCCCCAAGACCAGGCGCCAGGG[A/C]GAGGTGAGGGGACAGGCCGTGTGCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611180 | ||||||||||||||||||||
Literature Links: |
C9orf173-AS1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C9orf173-AS1 - C9orf173 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM166A - family with sequence similarity 166 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NELFB - negative elongation factor complex member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015456.4 | 804 | Silent Mutation | GGA,GGC | G,G 246 | NP_056271.3 |
STPG3 - sperm-tail PG-rich repeat containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |