Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCACATCAGGGACACCCGCAGGAT[A/G]GCGTAGCCCTCGTAGTCGGTGTCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609379 MIM: 612902 | ||||||||||||||||||||
Literature Links: |
LCN15 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LCN15 - lipocalin 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LCN6 - lipocalin 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LCN8 - lipocalin 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_178469.3 | 622 | Silent Mutation | GCC,GCT | A,A 91 | NP_848564.2 | |
XM_017014272.1 | 622 | Silent Mutation | GCC,GCT | A,A 114 | XP_016869761.1 |
LOC100128593 - uncharacterized LOC100128593 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6722 - microRNA 6722 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |