Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCGCTCTGCATGGGGAGTCCAGCG[C/T]TATTTATACCTGGACGAGTAATACT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 185641 MIM: 185640 MIM: 185620 MIM: 185642 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MED22 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MED22 - mediator complex subunit 22 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_133640.4 | 696 | Intron | NP_598395.1 | |||
NM_181491.2 | 696 | Silent Mutation | TAA,TAG | *,* 141 | NP_852468.1 |
RPL7A - ribosomal protein L7a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD24 - small nucleolar RNA, C/D box 24 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD36A - small nucleolar RNA, C/D box 36A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD36B - small nucleolar RNA, C/D box 36B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD36C - small nucleolar RNA, C/D box 36C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SURF1 - surfeit 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SURF6 - surfeit 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |