Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCTGTTCTTCCCACCTGCTGGTC[G/T]TCTTCTTCAGCCTGGCTAATCCGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609997 MIM: 108961 MIM: 605731 | ||||||||||||||||||||
Literature Links: |
FAM221B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM221B - family with sequence similarity 221 member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HINT2 - histidine triad nucleotide binding protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032593.2 | 384 | Missense Mutation | GAA,GAC | E,D 106 | NP_115982.1 |
NPR2 - natriuretic peptide receptor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPAG8 - sperm associated antigen 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |