Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCGAGCCCACACAGGAGGGAAAG[C/G]TCTTCCAGCTCTACCCCAGGAACTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613210 MIM: 611846 MIM: 612122 | ||||||||||||||||||||
Literature Links: |
DPH7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DPH7 - diphthamide biosynthesis 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPL41 - mitochondrial ribosomal protein L41 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032477.2 | 509 | Missense Mutation | CTC,GTC | L,V 127 | NP_115866.1 |
PNPLA7 - patatin like phospholipase domain containing 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |