Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCGCTGGGCCAGAAGCCTCAGAG[G/T]CCACGCCGGCCCGCATCCCCCATCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 120930 MIM: 609072 MIM: 612905 | ||||||||||||||||||||
Literature Links: |
C8G PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C8G - complement component 8, gamma polypeptide | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000606.2 | 150 | Missense Mutation | AGG,AGT | R,S 25 | NP_000597.2 |
FBXW5 - F-box and WD repeat domain containing 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018998.3 | 150 | Intron | NP_061871.1 | |||
XM_005266089.2 | 150 | Intron | XP_005266146.2 | |||
XM_011518789.1 | 150 | Intron | XP_011517091.1 | |||
XM_017014812.1 | 150 | Intron | XP_016870301.1 |
LCN12 - lipocalin 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |