Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCACAGAAGCACCACCAGCTGCAG[C/T]GCCAGGTAGACCACAAAGAGTGGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610714 | ||||||||||||||||||||
Literature Links: |
LOC100506100 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100506100 - uncharacterized LOC100506100 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PKN3 - protein kinase N3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317926.1 | 651 | Intron | NP_001304855.1 | |||
NM_013355.4 | 651 | Intron | NP_037487.2 | |||
XM_005251946.3 | 651 | Intron | XP_005252003.1 | |||
XM_006717080.2 | 651 | Intron | XP_006717143.1 | |||
XM_017014649.1 | 651 | Intron | XP_016870138.1 | |||
XM_017014650.1 | 651 | Intron | XP_016870139.1 |
ZDHHC12 - zinc finger DHHC-type containing 12 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318015.1 | 651 | Silent Mutation | GCA,GCG | A,A 202 | NP_001304944.1 | |
NM_001318016.1 | 651 | Silent Mutation | GCA,GCG | A,A 147 | NP_001304945.1 | |
NM_001318020.1 | 651 | Silent Mutation | GCA,GCG | A,A 147 | NP_001304949.1 | |
NM_001318023.1 | 651 | Silent Mutation | GCA,GCG | A,A 146 | NP_001304952.1 | |
NM_032799.4 | 651 | Silent Mutation | GCA,GCG | A,A 147 | NP_116188.2 | |
XM_011519116.2 | 651 | Silent Mutation | GCA,GCG | A,A 202 | XP_011517418.1 |
ZER1 - zyg-11 related cell cycle regulator | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |