Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCCCCCCTGGATGGTGACGGCGAT[C/G]ACTGAGGCACTCAGGTTCCTCCGAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610537 MIM: 604346 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DPP7 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DPP7 - dipeptidyl peptidase 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013379.2 | 1329 | Silent Mutation | GTC,GTG | V,V 433 | NP_037511.2 | |
XM_005266075.3 | 1329 | Silent Mutation | GTC,GTG | V,V 506 | XP_005266132.1 | |
XM_006717083.3 | 1329 | Missense Mutation | CAT,GAT | H,D 484 | XP_006717146.1 | |
XM_011518599.2 | 1329 | Silent Mutation | GTC,GTG | V,V 455 | XP_011516901.1 | |
XM_011518600.1 | 1329 | Silent Mutation | GTC,GTG | V,V 425 | XP_011516902.1 | |
XM_017014651.1 | 1329 | Missense Mutation | CAT,GAT | H,D 433 | XP_016870140.1 | |
XM_017014652.1 | 1329 | Missense Mutation | CAT,GAT | H,D 411 | XP_016870141.1 |
LOC101930307 - uncharacterized LOC101930307 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAN1B1 - mannosidase alpha class 1B member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |