Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCCCAGCACGGCGGGCAGGACGAG[A/G]CCTTTGCTTGTGCAACCTAGAGAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 131195 MIM: 136510 | ||||||||||||||||||||
Literature Links: |
ENG PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ENG - endoglin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000118.3 | 1916 | Silent Mutation | GGC,GGT | G,G 586 | NP_000109.1 | |
NM_001114753.2 | 1916 | Silent Mutation | GGC,GGT | G,G 586 | NP_001108225.1 | |
NM_001278138.1 | 1916 | Silent Mutation | GGC,GGT | G,G 404 | NP_001265067.1 |
FPGS - folylpolyglutamate synthase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC102723566 - uncharacterized LOC102723566 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |