Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCATCCAGCCGGATGACCTCTCCA[T/C]TGAGGAATGGGTTCTCGATGATGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300256 MIM: 300040 | ||||||||||||||||||||
Literature Links: |
HSD17B10 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HSD17B10 - hydroxysteroid 17-beta dehydrogenase 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001037811.2 | 771 | Missense Mutation | AAT,AGT | N,S 238 | NP_001032900.1 | |
NM_004493.2 | 771 | Missense Mutation | AAT,AGT | N,S 247 | NP_004484.1 |
RIBC1 - RIB43A domain with coiled-coils 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001031745.4 | 771 | Intron | NP_001026915.1 | |||
NM_001267053.3 | 771 | Intron | NP_001253982.1 | |||
NM_144968.3 | 771 | Intron | NP_659405.1 | |||
XM_005261988.3 | 771 | Intron | XP_005262045.1 | |||
XM_005261990.3 | 771 | Intron | XP_005262047.1 |
SMC1A - structural maintenance of chromosomes 1A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |