Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCACTGTGCTGCAGGAATGAATGA[C/T]GTCCTTCCTAACAGTCCGCCCTACT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 300197 MIM: 300081 MIM: 300394 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATP6AP1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATP6AP1 - ATPase H+ transporting accessory protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CH17-340M24.3 - uncharacterized protein BC009467 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DNASE1L1 - deoxyribonuclease I-like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAZ - tafazzin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000116.4 | 512 | Silent Mutation | GAC,GAT | D,D 219 | NP_000107.1 | |
NM_001303465.1 | 512 | Silent Mutation | GAC,GAT | D,D 223 | NP_001290394.1 | |
NM_181311.3 | 512 | Silent Mutation | GAC,GAT | D,D 189 | NP_851828.1 | |
NM_181312.3 | 512 | Silent Mutation | GAC,GAT | D,D 205 | NP_851829.1 | |
NM_181313.3 | 512 | Silent Mutation | GAC,GAT | D,D 175 | NP_851830.1 | |
XM_006724836.1 | 512 | Missense Mutation | GAC,GAT | D,D 237 | XP_006724899.1 | |
XM_006724837.1 | 512 | Missense Mutation | GAC,GAT | D,D 232 | XP_006724900.1 | |
XM_006724839.1 | 512 | Missense Mutation | GAC,GAT | D,D 193 | XP_006724902.1 | |
XM_006724841.3 | 512 | Missense Mutation | GAC,GAT | D,D 150 | XP_006724904.1 | |
XM_006724842.3 | 512 | Missense Mutation | GAC,GAT | D,D 120 | XP_006724905.1 | |
XM_011531189.1 | 512 | Missense Mutation | GAC,GAT | D,D 166 | XP_011529491.1 | |
XM_011531191.2 | 512 | Missense Mutation | GAC,GAT | D,D 127 | XP_011529493.1 | |
XM_017029761.1 | 512 | Missense Mutation | GAC,GAT | D,D 214 | XP_016885250.1 | |
XM_017029762.1 | 512 | Missense Mutation | GAC,GAT | D,D 207 | XP_016885251.1 | |
XM_017029763.1 | 512 | Missense Mutation | GAC,GAT | D,D 148 | XP_016885252.1 | |
XM_017029764.1 | 512 | Missense Mutation | GAC,GAT | D,D 126 | XP_016885253.1 | |
XM_017029765.1 | 512 | Missense Mutation | GAC,GAT | D,D 106 | XP_016885254.1 |