Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAACTTTATCAAAGTACTCACATC[A/G]TCTTTATCATTCACTGGCACTCCAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300663 MIM: 300880 MIM: 300620 | ||||||||||||||||||||
Literature Links: |
ATG4A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATG4A - autophagy related 4A cysteine peptidase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321287.1 | Intron | NP_001308216.1 | ||||
NM_001321288.1 | Intron | NP_001308217.1 | ||||
NM_001321289.1 | Intron | NP_001308218.1 | ||||
NM_001321290.1 | Intron | NP_001308219.1 | ||||
NM_052936.4 | Intron | NP_443168.2 | ||||
NM_178270.3 | Intron | NP_840054.1 | ||||
NM_178271.2 | Intron | NP_840055.1 | ||||
XM_011530841.2 | Intron | XP_011529143.1 | ||||
XM_011530842.1 | Intron | XP_011529144.1 |
PSMD10 - proteasome 26S subunit, non-ATPase 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002814.3 | Intron | NP_002805.1 | ||||
NM_170750.2 | Intron | NP_736606.1 |
VSIG1 - V-set and immunoglobulin domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |