Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAACACAGCTTCCACTGATACCCG[A/G]TCATATACCTGGAGGGAGAGAAGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300626 MIM: 311770 | ||||||||||||||||||||
Literature Links: |
ASB11 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ASB11 - ankyrin repeat and SOCS box containing 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIGA - phosphatidylinositol glycan anchor biosynthesis class A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002641.3 | 2137 | Intron | NP_002632.1 | |||
NM_020473.3 | 2137 | Intron | NP_065206.3 | |||
XM_011545539.2 | 2137 | Silent Mutation | GAC,GAT | D,D 168 | XP_011543841.1 | |
XM_017029581.1 | 2137 | Intron | XP_016885070.1 |