Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCCATGTAGCGCTTCCACTGCGCA[A/G]ATGTCCAGTCCCCCAAAAATCTCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 311010 MIM: 313440 MIM: 305370 | ||||||||||||||||||||
Literature Links: |
ARAF PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARAF - A-Raf proto-oncogene, serine/threonine kinase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYN1 - synapsin I | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006950.3 | 1236 | Silent Mutation | ATC,ATT | I,I 369 | NP_008881.2 | |
NM_133499.2 | 1236 | Silent Mutation | ATC,ATT | I,I 369 | NP_598006.1 |
TIMP1 - TIMP metallopeptidase inhibitor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |