Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTCGCGACAGGCCTCTCCTGAGCT[C/T]GGAGGTGAATTGCCTTTGCTCTCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300023 MIM: 300013 MIM: 312420 | ||||||||||||||||||||
Literature Links: |
ARHGAP4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARHGAP4 - Rho GTPase activating protein 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NAA10 - N(alpha)-acetyltransferase 10, NatA catalytic subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256119.1 | 814 | Silent Mutation | CCA,CCG | P,P 173 | NP_001243048.1 | |
NM_001256120.1 | 814 | Silent Mutation | CCA,CCG | P,P 182 | NP_001243049.1 | |
NM_003491.3 | 814 | Silent Mutation | CCA,CCG | P,P 188 | NP_003482.1 |
RENBP - renin binding protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |