Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTGCAGACCTTCGCGCGCACCGTG[G/T]CCCGGGGACCTGTGGCGCCCTCCAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600197 | ||||||||||||||||||||
Literature Links: |
LOC100128653 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100128653 - uncharacterized LOC100128653 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAFK - MAF bZIP transcription factor K | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002360.3 | 628 | Missense Mutation | GCC,TCC | A,S 122 | NP_002351.1 | |
XM_005249851.2 | 628 | Missense Mutation | GCC,TCC | A,S 122 | XP_005249908.2 | |
XM_006715773.2 | 628 | Missense Mutation | GCC,TCC | A,S 122 | XP_006715836.1 |
TMEM184A - transmembrane protein 184A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |