Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCGAGAGGACGGAGTGGGGCAGGGG[G/C]TAGGCTTGAGGGGTTTTGGGGGGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600214 MIM: 164951 MIM: 176311 | ||||||||||||||||||||
Literature Links: |
AGER PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AGER - advanced glycosylation end product-specific receptor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GPSM3 - G-protein signaling modulator 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001276501.1 | 653 | Missense Mutation | CCC,GCC | P,A 94 | NP_001263430.1 | |
NM_022107.2 | 653 | Missense Mutation | CCC,GCC | P,A 94 | NP_071390.1 |
NOTCH4 - notch 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PBX2 - PBX homeobox 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |