Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGAGGCGGAGGTGACCACAGGGAG[C/A]ACCGGTCCGAGGCTGCCGCTAGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602953 | ||||||||||||||||||||
Literature Links: |
HEY1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HEY1 - hes related family bHLH transcription factor with YRPW motif 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040708.1 | 662 | Silent Mutation | GTG,GTT | V,V 244 | NP_001035798.1 | |
NM_001282851.1 | 662 | Silent Mutation | GTG,GTT | V,V 150 | NP_001269780.1 | |
NM_012258.3 | 662 | Silent Mutation | GTG,GTT | V,V 240 | NP_036390.3 |
LINC01607 - long intergenic non-protein coding RNA 1607 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927040 - uncharacterized LOC101927040 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |