Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCGGCCCGCCAGGTGAGGCAGCGA[A/G]CAGGTCGCGGGGAGGCCGCGCCCCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
23 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602943 MIM: 615653 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C2CD4D PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C2CD4D - C2 calcium dependent domain containing 4D | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136003.1 | 1289 | Silent Mutation | TGC,TGT | C,C 80 | NP_001129475.1 | |
XM_011509055.2 | 1289 | Silent Mutation | TGC,TGT | C,C 80 | XP_011507357.1 | |
XM_016999989.1 | 1289 | Silent Mutation | TGC,TGT | C,C 80 | XP_016855478.1 |
LOC100132111 - uncharacterized LOC100132111 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RORC - RAR related orphan receptor C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
THEM5 - thioesterase superfamily member 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |