Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAATGCTGTCCCTTCAGGAGAGAA[C/T]CTGAAGTTTCCAGTAAAAAAGATGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
21 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614206 MIM: 176940 MIM: 601989 MIM: 607986 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CHTOP PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CHTOP - chromatin target of PRMT1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
S100A1 - S100 calcium binding protein A1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
S100A13 - S100 calcium binding protein A13 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001024210.1 | Intron | NP_001019381.1 | ||||
NM_001024211.1 | Intron | NP_001019382.1 | ||||
NM_001024212.1 | Intron | NP_001019383.1 | ||||
NM_001024213.1 | Intron | NP_001019384.1 | ||||
NM_005979.2 | Intron | NP_005970.1 | ||||
XM_005245434.3 | Intron | XP_005245491.1 | ||||
XM_011509862.2 | Intron | XP_011508164.1 | ||||
XM_011509863.2 | Intron | XP_011508165.1 | ||||
XM_011509864.1 | Intron | XP_011508166.1 | ||||
XM_017002034.1 | Intron | XP_016857523.1 | ||||
XM_017002035.1 | Intron | XP_016857524.1 | ||||
XM_017002036.1 | Intron | XP_016857525.1 |
S100A14 - S100 calcium binding protein A14 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |